| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Technical Briefs |
1
Laboratorio di Chimica Clinica e Microbiologia, Azienda Ospedaliera San Paolo, Via di Rudinì 8, 20142 Milan, Italy;
2
Clinica Pediatrica, Azienda Ospedaliera San Paolo, Università di Milano, Via di Rudinì 8, 20142 Milan, Italy;
a author for correspondence: fax 39-0289128221
Gilbert syndrome, a benign unconjugated hyperbilirubinemia without structural liver disease or overt hemolysis, is characterized by episodes of mild intermittent jaundice (1)(2)(3). Gilbert syndrome is the most common inherited variant of hepatic bilirubin metabolism, occurring in 2–12% of the population, and it is often detected in adulthood during routine blood tests. The most consistent feature in Gilbert syndrome is a deficiency in bilirubin glucuronidation, but the metabolism of drugs may also be affected(3).
Recently, the molecular basis of Gilbert syndrome was elucidated and found to result from molecular lesions in one of the isoforms of the UDP-glucuronosyl transferase (UGT-1A) gene. UGT-1A is encoded by the UDG gene complex, which is composed of multiple unique forms of exon 1, each one specific for a single isoenzymes, and four common exons (from two to five) (4). UGT-1A is responsible for bilirubin glucuronidation; the other isoenzymes of the complex are involved in the metabolism of a number of aromatic compounds(5).
The most common genetic alteration of UGT-1A is a TA insertion in the repetitive TATA-box of the gene promoter, which normally consists of six repeats. The TA(7) allele causes reduced expression of the gene, and homozygosity for this allele is typically associated with a mild form of Gilbert syndrome (6).
The aim of this study was to analyze the relationship between the TA variant reported by Bosma et al. (4) and the serum concentration of bilirubin in 98 unrelated subjects from all regions of Italy.
We collected whole blood (3 mL) into potassium EDTA and
heparin-containing tubes from 98 subjects: 45 females, ages 2–23
years, and 53 males, ages 2–30 years, unselected for serum bilirubin
concentrations and with no abnormal biochemical values. In our
laboratory, the upper limit of the serum total bilirubin (STB)
reference interval is 17.1 µmol/L. All of the subjects were
nonsmokers who had fasted overnight and who had not taken any
medication or alcohol in the 5 days before blood collection. We
measured alanine aminotransferase, albumin, alkaline phosphatase,
amylase, 
-glutamyltransferase, and total bilirubin on a Hitachi 917
(Roche Diagnostics). To measure total bilirubin, we used the Bilirubin
DPD Method, with an interassay CV of 8%. DNA was prepared using the
Istagene Matrix extraction kit (Bio-Rad Laboratories).
Primers (5' GTCACGTGACACAGTCAAAC 3' and 5' TTTGCTCCTGCCAGAGGTT 3') from Bosma et al. (4) were used to amplify a fragment of 98–100 bp. Amplifications (25 µL) were performed using the four deoxynucleotide triphosphates (0.1 mmol/L each), 0.25 µmol/L each primer, 1.5 mmol/L MgCl2, 0.5 U of Taq Polymerase, and 1x buffer from PE Applied Biosystem. The PCR conditions (Perkin-Elmer 2400 Thermal cycler) were as follows: 95 °C for 5 min, followed by 30 cycles of 95 °C for 30 s, 58 °C for 40 s, and 72 °C for 40 s.
Amplification was confirmed before direct sequencing by an automated capillary electrophoresis DNA sequencer (ABI PRISM 310; PE Applied Biosystem) and the Big Dye Terminator Kit (PE Applied Biosystem).
Mean serum bilirubin values were compared by ANOVA or a two-tailed
nonparametric Wilcoxon test. A t-test was used to evaluate
whether the difference in age between males and females was
significant; 
2 tests were used to assess
whether the distribution of the 6/6,
6/7, and 7/7 genotypes
between males and females was significant: P <0.05 was
considered significant.
Among 98 healthy subjects, 16 were homozygous for A(TA)7TAA (16.3%), 43 were homozygous for A(TA6)TAA (43.9%), and 39 were heterozygous (39.8%). The calculated allele frequency for the longer TATAA element was 0.36.
The mean (SD) serum bilirubin concentration was 7.7 (2.9) µmol/L in
the subjects who were homozygous for A(TA)6TAA, 9.6 (3.9)
µmol/L in the subjects who were heterozygous (P <0.05),
and 25.1 (15.9) µmol/L (P <0.001) in the subjects
homozygous for A(TA)7TAA (Table 1
.).
|
There were no significant differences in age or genotype distribution
between males and females. There also were no significant
differences in STB concentrations between males and females when
divided by genotype. The genotype frequencies and mean (SD) STB
concentrations for males and females are compared in Table 1
.
The clinical suspicion of Gilbert syndrome often is based on intermittent jaundice and/or a consistent mildly increased nonfasting total bilirubin as the sole abnormal liver-function test(1)(2).
The recent demonstration of a UGT-1A alteration in subjects with Gilbert syndrome (4) was confirmed by Monaghan et al.(6) in a Scottish population. Our study provides similar findings in an Italian population, without any differences between regional origins. Moreover, 7 of 16 subjects with the 7/7 genotype had STB within the reference interval. These data, in agreement with the recent study by Rudenski and Halsall (7), confirm that the Gilbert genotype is not always expressed.
There is a need to establish health-associated reference values for quantities measured in the clinical chemistry laboratory, but the idea of health is problematic (8)(9).
The high frequency of variant allele TA7 and its significant influence on STB suggests the desirability of exclusion of these subjects from the selection of reference individuals for bilirubin determination.
In our 43 subjects homozygous for the wild-type TA6 allele, the upper limit of the conventional 95% reference interval was 14.4 µmol/L, compared with the upper limit of 17.1 µmol/L currently used in our laboratory (10).
References
The following articles in journals at HighWire Press have cited this article:
|
|
 |
|
  E. Costa, E. Vieira, and R. dos Santos The Polymorphism c.-3279T>G in the Phenobarbital-Responsive Enhancer Module of the Bilirubin UDP-Glucuronosyltransferase Gene Is Associated with Gilbert Syndrome Clin. Chem., November 1, 2005; 51(11): 2204 - 2206. [Full Text] [PDF]
|
|
|
|
 |
|
 S. D. Zucker, X. Qin, S. D. Rouster, F. Yu, R. M. Green, P. Keshavan, J. Feinberg, and K. E. Sherman Mechanism of indinavir-induced hyperbilirubinemia PNAS, October 12, 2001; (2001) 231140698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Guillemette, I. De Vivo, S. E. Hankinson, C. A. Haiman, D. Spiegelman, D. E. Housman, and D. J. Hunter Association of Genetic Polymorphisms in UGT1A1 with Breast Cancer and Plasma Hormone Levels Cancer Epidemiol. Biomarkers Prev., June 1, 2001; 10(6): 711 - 714. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D. Zucker, X. Qin, S. D. Rouster, F. Yu, R. M. Green, P. Keshavan, J. Feinberg, and K. E. Sherman Mechanism of indinavir-induced hyperbilirubinemia PNAS, October 23, 2001; 98(22): 12671 - 12676. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
